Review



thermo scientific 7002  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier
Bioz Manufacturer Symbol Thermo Fisher manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 96
      Buy from Supplier

    Structured Review

    Thermo Fisher thermo scientific 7002
    Thermo Scientific 7002, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/rnase+away/RNase+AWAY+surface+Decontaminant/bio_rxiv__64898__2026__03__31__715596-429-14-14
    Average 96 stars, based on 1 article reviews
    thermo scientific 7002 - by Bioz Stars, 2026-11
    96/100 stars

    Images

    Related Articles

    Dissection:

    Article Title: Strain variation identifies a neural substrate for behavioral evolution in Drosophila.
    Article Snippet: .. The CO 2 pad, forceps, and scalpels were cleaned with 70% ethanol and RNase-away (ThermoFisher #7003) after every round of dissection. ..

    Article Title: Strain variation identifies a neural substrate for behavioral evolution in Drosophila
    Article Snippet: .. The CO 2 pad, forceps, and scalpels were cleaned with 70% ethanol and RNase-away (ThermoFisher #7003) after every round of dissection. .. The foreleg was removed by forceps below the sex comb, transferred to DNA Lo-bind nuclease-free tubes (Fisher Scientific #13-698-790), and once 100 legs were collected (or 20 minutes had elapsed), the tube was flash-frozen in liquid nitrogen.

    Software:

    Article Title: Coordinated differentiation of human intestinal organoids with functional enteric neurons and vasculature.
    Article Snippet: All stem cell and organoid lines were routinely monitored for mycoplasma using the MycoAlert Mycoplasma Detection Kit (Lonza Cat#LT07-318). .. REAGENT or RESOURCE SOURCE IDENTIFIER iPSC 72.3 Cincinnati Children’s Hospital (McCracken et al.49) RVECs Weill Cornell Medicine (Palikuqi et al.28) Experimental models: Organisms/strains NOD-scid IL2Rg-null (NSG) mice Jackson Laboratory Strain#0005557 Oligonucleotides Primer: RN18S-forward GCAGAATCCACGCCAGTACAAG IDT N/A Primer: RN18S-reverse GCTTGTTGTCCAGACCATTGGC IDT N/A Primer: TAGLN-forward ACCCTCCATGGTCTTCAAGCAGAT IDT N/A Primer: TAGLN-reverse ATCTCCACGGTAGTGCCCATCATT IDT N/A Primer: CDH5-forward CATCTTCCCAGGAGGAACAG IDT N/A Primer: CDH5-reverse AGAGCTCCACTCACGCTCAG IDT N/A Primer: RET-forward CATTGGGCCTCTACTTCTCGRET IDT N/A Primer: RET-reverse GTGTCCTCCTGGATGCAGAT IDT N/A Primer: TUBB3-forward CCCAGTATGAGGGAGATCGT IDT N/A Primer: TUBB3-reverse CGATGCCATGCTCATCAC IDT N/A See Table S2 for all other primer sequences IDT N/A Software and algorithms Prism 9.4.1 GraphPad https://www.graphpad.com/ scientific-software/prism/ Adobe Photoshop 2023 Adobe https://www.adobe.com Adobe Illustrator 2023 Adobe https://www.adobe.com Scanpy (Wolf et al. 2018)46 https://github.com/theislab/scanpy Seurat (Satija et al. 2015)47 https://satijalab.org/seurat/ Python Python https://www.python.org/ R Studio Cran https://cran.rstudio.com/ Cellranger 103 https://support.10xgenomics.com/ single-cell-gene-expression/software/ pipelines/latest/what-is-cell-ranger FlowJo BD https://www.flowjo.com/ ImageJ Schneider et al. (2012)48 https://imagej.nih.gov/ij/ Detailed methods and code for scRNAseq analysis GitHub https://github.com/jason-spence- lab/Childs_2023 Other Matrigel Corning Cat#354234 Histo-Clear II National Diagnostics Cat#HS-202 UltraPure DNase/RNase-Free Distilled Water Thermo Fisher Cat#10977015 RNase Away Thermo Fisher Cat700511 ProLong Gold Thermo Fisher Cat#P369300 TSA Plus Cyanine 3 (1:1500-2000) Akoya Biosciences Cat#NEL744001KT Mouse anti-VE-CAD R&D Systems Cat#MAB9381; RRID: AB_2260374 CellTracker Red CMTPX Thermo Fischer Cat#34552 CellTracker Deep Red Thermo Fischer Cat#34565 FluoSpheres Thermo Fischer Cat#F8829 Cell Stem Cell 32, 1–12.e1–e9, April 3, 2025 e3 .. All fluorescence images were taken on a Nikon AXR confocal microscope.

    other:

    Article Title: Stable isotope probing of carbonyl sulfide and cyanate pathways in microbial thiocyanate biodegradation
    Article Snippet: All plasticware used was certified RNase-free, and the extraction environment and pipettors were cleaned using the MoBio UltraCleanTM Laboratory Cleaner and Invitrogen RNase AWAY.

    Article Title: mRNA lipid nanoparticle formulation, characterization and evaluation.
    Article Snippet: mRNA-based therapies have emerged as a cutting-edge approach for diverse therapeutic applications.. However, substantial barriers exist that hinder scientists from entering this research field, including the technical complexity and multiple potential workflows available for formulating and evaluating mRNA lipid nanoparticles (LNPs).. Here we present an easy-to-follow and step-by-step guide for mRNA LNP formulation, characterization and in vitro and in vivo evaluation that could lower these barriers, facilitating entry for scientists in academia, industry and clinical settings into this research space.



    Similar Products

    dnase and rnase away  (Fisher Scientific)
    86
    Fisher Scientific dnase and rnase away
    Dnase And Rnase Away, supplied by Fisher Scientific, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/rnase+away/rnase/pmc13188093-27-0-5
    Average 86 stars, based on 1 article reviews
    dnase and rnase away - by Bioz Stars, 2026-11
    86/100 stars
    		  Buy from Supplier
    thermo scientific 7002  (Thermo Fisher)
    96
    Thermo Fisher thermo scientific 7002
    Thermo Scientific 7002, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/rnase+away/RNase+AWAY+surface+Decontaminant/bio_rxiv__64898__2026__03__31__715596-429-14-14
    Average 96 stars, based on 1 article reviews
    thermo scientific 7002 - by Bioz Stars, 2026-11
    96/100 stars
    		  Buy from Supplier
    thermofisher 7003pk  (Thermo Fisher)
    96
    Thermo Fisher thermofisher 7003pk
    Thermofisher 7003pk, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/rnase+away/RNase+AWAY+surface+Decontaminant/bio_rxiv__64898__2026__03__09__707564-87-14-14
    Average 96 stars, based on 1 article reviews
    thermofisher 7003pk - by Bioz Stars, 2026-11
    96/100 stars
    		  Buy from Supplier
    rnase away  (Thermo Fisher)
    96
    Thermo Fisher rnase away
    Rnase Away, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/rnase+away/RNase+AWAY+surface+Decontaminant/pm41763206-348-13-14
    Average 96 stars, based on 1 article reviews
    rnase away - by Bioz Stars, 2026-11
    96/100 stars
    		  Buy from Supplier
    rnase awaytm surface decontaminant  (Thermo Fisher)
    96
    Thermo Fisher rnase awaytm surface decontaminant
    Rnase Awaytm Surface Decontaminant, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/rnase+away/RNase+AWAY+surface+Decontaminant/pm41772634-50-9-15
    Average 96 stars, based on 1 article reviews
    rnase awaytm surface decontaminant - by Bioz Stars, 2026-11
    96/100 stars
    		  Buy from Supplier
    real time pcr apparatus  (Thermo Fisher)
    96
    Thermo Fisher real time pcr apparatus
    BMI1 knockdown in HDFs induces laminopathy . A , immunofluorescence analysis of HDFs at 24 h post-transfection with shScramble or shBMI1 plasmids. Scale bar: 10 μm. Deformation of the nuclear envelope, as labeled with Lamin A/C, was more frequent in shBMI1 HDFs ( arrows ). The bottom panel is a high magnification of cells with nuclear envelope deformation. Results are the sum of three experiments with 50 cells/experiment. Statistical differences were analyzed using an unpaired t test with two tails. ∗∗ p -value = 0.0092. All values are mean ± S.D. B , Western blot analysis of HDFs at 24 h post-transfection with shScramble or shBMI1 plasmids. Note BMI1 reduction in shBMI1 cells. Dashed black arrows indicate the position where the bands were cut from the original blots. The protein ladder indicates the molecular weight (MW) relative to the revealed bands. C <t>,</t> <t>real-time</t> <t>PCR</t> analysis of HDFs at 24 h post-transfection with shScramble or shBMI1 plasmids. While BMI1 expression was reduced and P16INKA was increased in shBMI1 cells, progerin levels were unaffected. Results are the sum of three experiments, with three replicates/experiment. Statistical differences were analyzed using an unpaired t test with two tails. ∗ p -value = 0.038, and ∗∗ p -value = 0.0043. All values are mean ± S.D.
    Real Time Pcr Apparatus, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/rnase+away/RNase+AWAY+surface+Decontaminant/pmc12919260-326-12-15
    Average 96 stars, based on 1 article reviews
    real time pcr apparatus - by Bioz Stars, 2026-11
    96/100 stars
    		  Buy from Supplier
    rnase  (Thermo Fisher)
    95
    Thermo Fisher rnase
    BMI1 knockdown in HDFs induces laminopathy . A , immunofluorescence analysis of HDFs at 24 h post-transfection with shScramble or shBMI1 plasmids. Scale bar: 10 μm. Deformation of the nuclear envelope, as labeled with Lamin A/C, was more frequent in shBMI1 HDFs ( arrows ). The bottom panel is a high magnification of cells with nuclear envelope deformation. Results are the sum of three experiments with 50 cells/experiment. Statistical differences were analyzed using an unpaired t test with two tails. ∗∗ p -value = 0.0092. All values are mean ± S.D. B , Western blot analysis of HDFs at 24 h post-transfection with shScramble or shBMI1 plasmids. Note BMI1 reduction in shBMI1 cells. Dashed black arrows indicate the position where the bands were cut from the original blots. The protein ladder indicates the molecular weight (MW) relative to the revealed bands. C <t>,</t> <t>real-time</t> <t>PCR</t> analysis of HDFs at 24 h post-transfection with shScramble or shBMI1 plasmids. While BMI1 expression was reduced and P16INKA was increased in shBMI1 cells, progerin levels were unaffected. Results are the sum of three experiments, with three replicates/experiment. Statistical differences were analyzed using an unpaired t test with two tails. ∗ p -value = 0.038, and ∗∗ p -value = 0.0043. All values are mean ± S.D.
    Rnase, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/rnase+away/RNase+AWAY+surface+Decontaminant/bio_rxiv__64898__2025__12__16__694604-79-21-23
    Average 95 stars, based on 1 article reviews
    rnase - by Bioz Stars, 2026-11
    95/100 stars
    		  Buy from Supplier
    emd 7002 title  (Thermo Fisher)
    97
    Thermo Fisher emd 7002 title
    BMI1 knockdown in HDFs induces laminopathy . A , immunofluorescence analysis of HDFs at 24 h post-transfection with shScramble or shBMI1 plasmids. Scale bar: 10 μm. Deformation of the nuclear envelope, as labeled with Lamin A/C, was more frequent in shBMI1 HDFs ( arrows ). The bottom panel is a high magnification of cells with nuclear envelope deformation. Results are the sum of three experiments with 50 cells/experiment. Statistical differences were analyzed using an unpaired t test with two tails. ∗∗ p -value = 0.0092. All values are mean ± S.D. B , Western blot analysis of HDFs at 24 h post-transfection with shScramble or shBMI1 plasmids. Note BMI1 reduction in shBMI1 cells. Dashed black arrows indicate the position where the bands were cut from the original blots. The protein ladder indicates the molecular weight (MW) relative to the revealed bands. C <t>,</t> <t>real-time</t> <t>PCR</t> analysis of HDFs at 24 h post-transfection with shScramble or shBMI1 plasmids. While BMI1 expression was reduced and P16INKA was increased in shBMI1 cells, progerin levels were unaffected. Results are the sum of three experiments, with three replicates/experiment. Statistical differences were analyzed using an unpaired t test with two tails. ∗ p -value = 0.038, and ∗∗ p -value = 0.0043. All values are mean ± S.D.
    Emd 7002 Title, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/rnase+away/RNase+AWAY+surface+Decontaminant/emdb_07002-0-16-19
    Average 97 stars, based on 1 article reviews
    emd 7002 title - by Bioz Stars, 2026-11
    97/100 stars
    		  Buy from Supplier

    Image Search Results


    BMI1 knockdown in HDFs induces laminopathy . A , immunofluorescence analysis of HDFs at 24 h post-transfection with shScramble or shBMI1 plasmids. Scale bar: 10 μm. Deformation of the nuclear envelope, as labeled with Lamin A/C, was more frequent in shBMI1 HDFs ( arrows ). The bottom panel is a high magnification of cells with nuclear envelope deformation. Results are the sum of three experiments with 50 cells/experiment. Statistical differences were analyzed using an unpaired t test with two tails. ∗∗ p -value = 0.0092. All values are mean ± S.D. B , Western blot analysis of HDFs at 24 h post-transfection with shScramble or shBMI1 plasmids. Note BMI1 reduction in shBMI1 cells. Dashed black arrows indicate the position where the bands were cut from the original blots. The protein ladder indicates the molecular weight (MW) relative to the revealed bands. C , real-time PCR analysis of HDFs at 24 h post-transfection with shScramble or shBMI1 plasmids. While BMI1 expression was reduced and P16INKA was increased in shBMI1 cells, progerin levels were unaffected. Results are the sum of three experiments, with three replicates/experiment. Statistical differences were analyzed using an unpaired t test with two tails. ∗ p -value = 0.038, and ∗∗ p -value = 0.0043. All values are mean ± S.D.

    Journal: The Journal of Biological Chemistry

    Article Title: BMI1 represses G-quadruplex DNA formation to maintain genomic stability during replication

    doi: 10.1016/j.jbc.2026.111172

    Figure Lengend Snippet: BMI1 knockdown in HDFs induces laminopathy . A , immunofluorescence analysis of HDFs at 24 h post-transfection with shScramble or shBMI1 plasmids. Scale bar: 10 μm. Deformation of the nuclear envelope, as labeled with Lamin A/C, was more frequent in shBMI1 HDFs ( arrows ). The bottom panel is a high magnification of cells with nuclear envelope deformation. Results are the sum of three experiments with 50 cells/experiment. Statistical differences were analyzed using an unpaired t test with two tails. ∗∗ p -value = 0.0092. All values are mean ± S.D. B , Western blot analysis of HDFs at 24 h post-transfection with shScramble or shBMI1 plasmids. Note BMI1 reduction in shBMI1 cells. Dashed black arrows indicate the position where the bands were cut from the original blots. The protein ladder indicates the molecular weight (MW) relative to the revealed bands. C , real-time PCR analysis of HDFs at 24 h post-transfection with shScramble or shBMI1 plasmids. While BMI1 expression was reduced and P16INKA was increased in shBMI1 cells, progerin levels were unaffected. Results are the sum of three experiments, with three replicates/experiment. Statistical differences were analyzed using an unpaired t test with two tails. ∗ p -value = 0.038, and ∗∗ p -value = 0.0043. All values are mean ± S.D.

    Article Snippet: Real-time PCR was carried in triplicates using Platinum SYBRGreen Supermix (Invitrogen) and Real-time PCR apparatus (ABI prism 7002).

    Techniques: Knockdown, Immunofluorescence, Transfection, Labeling, Western Blot, Molecular Weight, Real-time Polymerase Chain Reaction, Expressing